ID: 1197310475

View in Genome Browser
Species Human (GRCh38)
Location X:124899202-124899224
Sequence ATGTAGTACTTTAGGTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197310475_1197310478 16 Left 1197310475 X:124899202-124899224 CCTTGTTACCTAAAGTACTACAT 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1197310478 X:124899241-124899263 AAAGTTCAGCAGCGTGATCAGGG 0: 1
1: 0
2: 0
3: 74
4: 915
1197310475_1197310477 15 Left 1197310475 X:124899202-124899224 CCTTGTTACCTAAAGTACTACAT 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1197310477 X:124899240-124899262 TAAAGTTCAGCAGCGTGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197310475 Original CRISPR ATGTAGTACTTTAGGTAACA AGG (reversed) Intronic
905705181 1:40050936-40050958 ATGGAGTATTATAGGGAACAAGG - Intronic
906161735 1:43654750-43654772 TTGTTTTACTTTATGTAACAAGG - Intronic
906905825 1:49891010-49891032 AGGTACTACTTTAGATAAGATGG + Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
909161764 1:72160741-72160763 AATTACTACTTTATGTAACAGGG + Intronic
916919454 1:169448447-169448469 ATGTAGAATTATAGGTTACAGGG + Intronic
918330019 1:183449945-183449967 AAGTACTATTTTAGGTAAGATGG - Intergenic
920602181 1:207338196-207338218 ATGTACTACTTATGGAAACATGG - Intronic
922883094 1:228997342-228997364 ATGAAGTGCTATAGGTAAAAAGG + Intergenic
1063581252 10:7309669-7309691 ATGTAGTAGGGTAAGTAACAAGG - Intronic
1068368792 10:56087088-56087110 ATGAAGCACTTTGGGTAGCAAGG + Intergenic
1069342901 10:67433203-67433225 ATTTTGTACTTCAGGTAATAGGG + Intronic
1072080483 10:92025104-92025126 ATGTAGTTCTATAGTTAAAAAGG - Intronic
1072172208 10:92875961-92875983 ATGGAGTACTTTTGGTTATAAGG - Intronic
1073901390 10:108225719-108225741 AGGTTGTACTTTATTTAACATGG - Intergenic
1073965559 10:108985078-108985100 ATGTACAACTTGAGGTTACAGGG + Intergenic
1079693001 11:23443123-23443145 AAGTAGTCATTTTGGTAACATGG + Intergenic
1082558999 11:54596871-54596893 ATATACTACCTTAGGCAACATGG + Intergenic
1084295431 11:68210735-68210757 ATGCAGTATTGTAGCTAACAGGG + Intronic
1085870421 11:80342979-80343001 GTGCAGAATTTTAGGTAACAGGG - Intergenic
1087937233 11:104049208-104049230 ATATAGTAGTTTAGACAACAGGG + Intronic
1088752862 11:112859592-112859614 ATGAAATACATTAGGTATCAAGG + Intergenic
1092966727 12:13650985-13651007 ATGAAGTCCTTTAGGTTAAATGG - Intronic
1093693584 12:22135516-22135538 AAGCAGTACTTTAGCTAACACGG + Intronic
1094224410 12:28029120-28029142 ATGTAGTATTTCACCTAACAGGG + Intergenic
1095823611 12:46508096-46508118 ATGTAGTCCTCTAGGTATCAGGG + Intergenic
1096438386 12:51616114-51616136 ATTTAGAACTTCAGGAAACAAGG - Intronic
1097095027 12:56540214-56540236 AGGTACTACGTTAGGTACCAAGG - Intronic
1097324480 12:58260294-58260316 ATGTAGTACTTAAGAACACAGGG - Intergenic
1098094468 12:66939724-66939746 ATGGAGTTCTCTAGGTATCAAGG + Intergenic
1098449322 12:70601572-70601594 ATGTAGCATTTTATGTAAAATGG + Intronic
1099520820 12:83659327-83659349 CTGTAGTACTTGTGGTAACATGG + Intergenic
1099759762 12:86903616-86903638 CTGTGGTACACTAGGTAACAAGG + Intergenic
1101866088 12:108520616-108520638 ATGTAGTGCTCTATGTAATATGG + Exonic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104414536 12:128587157-128587179 ATGTAATACTTTGGGCAATAAGG - Intronic
1109321822 13:60819229-60819251 ATGTTGTTCTTTGGGTCACAAGG + Intergenic
1110163968 13:72414663-72414685 ATGAATTACTTTATGTGACATGG + Intergenic
1111179737 13:84648301-84648323 ATGTAGTTTTTTTGTTAACATGG + Intergenic
1112630062 13:101150575-101150597 ATGTAATACTTTGTGTATCATGG - Intronic
1115385869 14:32796054-32796076 ATGTAGGAATATAGCTAACAAGG + Intronic
1117941775 14:60974911-60974933 ATGTTATAATTTAGATAACAGGG + Exonic
1118067492 14:62207585-62207607 ATGTTGTTCTTTATGTGACAAGG + Intergenic
1120549714 14:85855281-85855303 ATGGAGTACTTCAGTAAACAAGG + Intergenic
1123216771 14:106815470-106815492 TTGTAGTATTTGAGGTAAAAAGG + Intergenic
1126061905 15:44791120-44791142 ATGTATTACTTTACTTCACAAGG + Intergenic
1126892552 15:53222108-53222130 CTGTAGCACTTGAGGTGACAGGG + Intergenic
1128411210 15:67400222-67400244 TTGTAGCACTTTAGGTAGGAAGG - Exonic
1131582571 15:93659386-93659408 GTATAGTACCTGAGGTAACAGGG + Intergenic
1133499488 16:6352305-6352327 AAGTACTACTTTAGGTACAATGG - Intronic
1139177465 16:64706731-64706753 ATGTAGCATTTTTAGTAACATGG - Intergenic
1143842799 17:9746742-9746764 CTGTAGTACTACAGGTAGCAAGG + Intergenic
1145955942 17:28854735-28854757 ATGTAGTCTTTTAGGAGACATGG + Intronic
1150415242 17:64982676-64982698 ATTTAGTAATTTAAGAAACAGGG - Intergenic
1152156019 17:78633269-78633291 CTGTAGTAATTTAAATAACATGG - Intergenic
1153899303 18:9602034-9602056 ATTCAGTTCTATAGGTAACAAGG - Intronic
1154474938 18:14747097-14747119 ACTTTGTACTTTAAGTAACATGG - Intronic
1155459716 18:26064042-26064064 ATTTAATAATTTAGGTAAAATGG + Intronic
1156127957 18:33930975-33930997 ATGTAGTACTTTTGGTTTAAGGG - Intronic
1156248482 18:35327069-35327091 ATGCAGTACTTTAGTTCACATGG + Intergenic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1158064945 18:53395422-53395444 AAGAAGTATTTTAGGTAAGAGGG - Intronic
1163485846 19:17585247-17585269 TTGCAGTAGCTTAGGTAACATGG - Intergenic
1166597717 19:44065004-44065026 ATGTAGGTCTTTAGGTCACAGGG - Intronic
1168614958 19:57830152-57830174 ATGTAGTTCCCTAGGTAACAAGG - Intronic
1168622304 19:57889157-57889179 ATGTAGTTCCCTAGGCAACAAGG + Intronic
926091081 2:10050093-10050115 TGGAAGTACTTTAGGAAACATGG - Intronic
927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG + Intergenic
928814445 2:35274114-35274136 GTGTAGTAGTTTAGATAACCAGG + Intergenic
929786256 2:44994769-44994791 ATGTAGTAATTTAGGGACCCAGG + Intergenic
931354542 2:61523859-61523881 ATGTAGTACTTTAGTTGAAATGG - Intronic
935840032 2:107098941-107098963 ATGTGGTCATTTAGGTAGCACGG + Intergenic
939025477 2:137008510-137008532 GTATAGTACTTTAGTTAACCAGG + Intronic
939507448 2:143065224-143065246 TTTTAATACTTAAGGTAACATGG + Intergenic
942090076 2:172481212-172481234 AACTACTACTTTAGATAACAGGG - Intronic
942843012 2:180386904-180386926 ATGTAGAACTTTAAGGGACAAGG - Intergenic
944968430 2:204962645-204962667 CTGAAGTAATTTAGTTAACAAGG + Intronic
945284949 2:208072898-208072920 ATGTAATACTTTAATAAACAGGG - Intergenic
1170927182 20:20736210-20736232 ATGTATTACTTTTGATAACTAGG + Intergenic
1173844162 20:46177623-46177645 ATGTAGGACTTTTAGTAAAAAGG - Intronic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1177022204 21:15875991-15876013 ATGTAGTACGGTAGGTATGATGG + Intronic
1177434174 21:21029066-21029088 ATGTTTTAGTGTAGGTAACAAGG + Intronic
952526376 3:34214788-34214810 ATGTATTACTTTACTTCACAAGG - Intergenic
956651956 3:71512465-71512487 ATATGGTGCTTTTGGTAACAAGG - Intronic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
958667743 3:97161873-97161895 ATGTAATAATTTAGTTCACAAGG - Intronic
963669580 3:148235012-148235034 ATGTAATGCTTTTAGTAACATGG + Intergenic
968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG + Intronic
971062967 4:22993169-22993191 ATATAGTACTTTAGGTGATGAGG + Intergenic
971689136 4:29810554-29810576 CTGTAGTAGTTAAGGTAAAAGGG - Intergenic
971695552 4:29898512-29898534 ATGTGGTAAGTTAGGAAACAGGG - Intergenic
972501417 4:39681365-39681387 ATGTTGTTCTTTGGGTATCAAGG + Intergenic
972634829 4:40874255-40874277 ATGTAAGAATTTAGTTAACAGGG - Intronic
974447191 4:62000392-62000414 ATGTATTTCTTTAGGTAATGTGG + Intronic
975251908 4:72190102-72190124 ATGTATTACTTTGGGGAGCATGG - Intergenic
975491903 4:74998490-74998512 ATTAAATACTTTAAGTAACAAGG - Intronic
982787423 4:159552081-159552103 AGGAAGTACTTTAGCTTACAAGG + Intergenic
984058502 4:174961231-174961253 ATGTATTACTGTATGTAAAAAGG - Intronic
993853606 5:93042531-93042553 AAGTTTTACTTTATGTAACATGG + Intergenic
994003872 5:94814964-94814986 AGGTGGTACTATAGGTAACTTGG - Intronic
994728948 5:103469713-103469735 ATGTAGTATTTCGGGGAACAGGG - Intergenic
994852192 5:105070207-105070229 ATGTATTACCTTATGTAACTAGG + Intergenic
1001236956 5:170038220-170038242 ATGAAGTACTATAGGTAATATGG + Intronic
1001427319 5:171631291-171631313 ATGTATTACTTTAGTAATCAGGG - Intergenic
1003451239 6:6234364-6234386 ATGAAGTACTTCAGGGAATATGG + Intronic
1004220471 6:13742503-13742525 AGGGAGTACTTTGGGTCACATGG + Intergenic
1004949493 6:20652613-20652635 ATGTAGGACAATAGCTAACAGGG - Intronic
1007493253 6:42240795-42240817 ATGTAGTGCTGTGGGTAACCCGG - Intronic
1008200231 6:48578217-48578239 ATGTAACACTTTAGGCAAAAGGG + Intergenic
1008402610 6:51081109-51081131 AGGTAATACTGTAAGTAACAAGG - Intergenic
1008707077 6:54175319-54175341 CTGTAGTACTTTGGGTAGTATGG + Intronic
1012219802 6:96635418-96635440 ATTTATTACTCTAGGTAGCATGG + Intergenic
1012870496 6:104667596-104667618 ATGTAGGAATTCAGCTAACAAGG + Intergenic
1013657072 6:112257012-112257034 ATGTAGTACTTTTGGGAGCTTGG + Intergenic
1014474422 6:121854634-121854656 GTGAAGTTCTTTAGGTAACTGGG - Intergenic
1016827503 6:148402211-148402233 TGGCAGTACTTTAGGTAGCAAGG - Intronic
1019403520 7:869710-869732 GTGTAGTACTGTATGTAAAATGG - Intronic
1021250370 7:18317865-18317887 ATGAAGAACTTTTGGCAACACGG - Intronic
1022051267 7:26675821-26675843 ATGTAGTACATTTGAAAACATGG - Intronic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1028150213 7:87363614-87363636 ATATAGTACTTTATAAAACAAGG + Intronic
1028601669 7:92607469-92607491 ATGTAGTATTTTGGGTATCTAGG - Exonic
1029691520 7:102185203-102185225 ATGTAGTAATTGTAGTAACAAGG + Intronic
1038385329 8:27139266-27139288 TTGGAGTACTTTATATAACATGG + Intergenic
1040656748 8:49519296-49519318 ATGTGGGACTTTGTGTAACAGGG - Intergenic
1042297264 8:67234678-67234700 ATGTACTACTTTCGAAAACAGGG + Intronic
1043470521 8:80557774-80557796 ATGAAGAACTTTTGGCAACAGGG + Intergenic
1044116747 8:88345054-88345076 ATCTAGTAATATAGCTAACAAGG - Intergenic
1045798509 8:106074847-106074869 ATGTAGGAGTTTAGCTTACATGG + Intergenic
1047191870 8:122685663-122685685 ATGTTATCCTGTAGGTAACAGGG - Intergenic
1047241173 8:123089897-123089919 ATGTAGAACTTTAGGAGACCTGG - Intronic
1048257862 8:132918942-132918964 ATGTATTAATGTATGTAACAGGG + Intronic
1050870444 9:10561484-10561506 ATGCAGTATTCTAGGTAATAGGG - Intronic
1051839928 9:21384226-21384248 ATGTTGTACTCAAGATAACAAGG - Intergenic
1057377463 9:94538093-94538115 TTGCAGTACTTTATGTGACAGGG + Intergenic
1058046116 9:100358687-100358709 ATCTATTACTTTACTTAACAAGG - Intergenic
1185857718 X:3551241-3551263 TTATAGTATTTTAGGAAACAGGG + Intergenic
1188446670 X:30259997-30260019 CTGTAGTAGTTTATATAACAAGG - Intergenic
1189243804 X:39546984-39547006 ATGAATTACTTTGGGTAATATGG - Intergenic
1191022172 X:55873859-55873881 ATGGAGTACTATATGTAATAAGG + Intergenic
1194332761 X:92603744-92603766 CTTTAGTATTTTATGTAACATGG - Intronic
1196347932 X:114688542-114688564 ATGTAGTACTTTTGCTACCTGGG + Intronic
1197310475 X:124899202-124899224 ATGTAGTACTTTAGGTAACAAGG - Intronic
1199316107 X:146379727-146379749 CTGTAGTACTGTTGGTTACAGGG + Intergenic
1199446815 X:147933723-147933745 ATGTATTACTTTATATAAAATGG - Intronic
1199587203 X:149428012-149428034 ATACATTACTTTAGGTAATATGG - Intergenic
1200641456 Y:5722788-5722810 CTTTAGTATTTTATGTAACATGG - Intronic