ID: 1197317702

View in Genome Browser
Species Human (GRCh38)
Location X:124988436-124988458
Sequence CTAGTTCAAAAGTTCCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197317702_1197317703 -10 Left 1197317702 X:124988436-124988458 CCAAAAGGGAACTTTTGAACTAG No data
Right 1197317703 X:124988449-124988471 TTTGAACTAGAGAATTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197317702 Original CRISPR CTAGTTCAAAAGTTCCCTTT TGG (reversed) Intergenic
No off target data available for this crispr