ID: 1197318003

View in Genome Browser
Species Human (GRCh38)
Location X:124992220-124992242
Sequence TCCAGGACAGTCTTGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197318003_1197318007 10 Left 1197318003 X:124992220-124992242 CCCACTGCCAAGACTGTCCTGGA No data
Right 1197318007 X:124992253-124992275 GCTCTGCCTAGCCCTCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197318003 Original CRISPR TCCAGGACAGTCTTGGCAGT GGG (reversed) Intergenic
No off target data available for this crispr