ID: 1197322030 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:125044342-125044364 |
| Sequence | CTTTGCAAGGCTGAGGTGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197322024_1197322030 | -8 | Left | 1197322024 | X:125044327-125044349 | CCTATAATCCCAGCACTTTGCAA | 0: 31 1: 1711 2: 42614 3: 343985 4: 249322 |
||
| Right | 1197322030 | X:125044342-125044364 | CTTTGCAAGGCTGAGGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197322030 | Original CRISPR | CTTTGCAAGGCTGAGGTGGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||