ID: 1197322030

View in Genome Browser
Species Human (GRCh38)
Location X:125044342-125044364
Sequence CTTTGCAAGGCTGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197322024_1197322030 -8 Left 1197322024 X:125044327-125044349 CCTATAATCCCAGCACTTTGCAA 0: 31
1: 1711
2: 42614
3: 343985
4: 249322
Right 1197322030 X:125044342-125044364 CTTTGCAAGGCTGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197322030 Original CRISPR CTTTGCAAGGCTGAGGTGGA AGG Intergenic
No off target data available for this crispr