ID: 1197324761

View in Genome Browser
Species Human (GRCh38)
Location X:125078998-125079020
Sequence CAAGTTCTCCAGAGTTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197324757_1197324761 17 Left 1197324757 X:125078958-125078980 CCCATTTCACAGACGAATAAACT No data
Right 1197324761 X:125078998-125079020 CAAGTTCTCCAGAGTTACACAGG No data
1197324758_1197324761 16 Left 1197324758 X:125078959-125078981 CCATTTCACAGACGAATAAACTG No data
Right 1197324761 X:125078998-125079020 CAAGTTCTCCAGAGTTACACAGG No data
1197324760_1197324761 -10 Left 1197324760 X:125078985-125079007 CCAGGAGCTTACGCAAGTTCTCC No data
Right 1197324761 X:125078998-125079020 CAAGTTCTCCAGAGTTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197324761 Original CRISPR CAAGTTCTCCAGAGTTACAC AGG Intergenic
No off target data available for this crispr