ID: 1197331432

View in Genome Browser
Species Human (GRCh38)
Location X:125158007-125158029
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197331432_1197331436 -4 Left 1197331432 X:125158007-125158029 CCTAACCTGAAAACAGAGACATC No data
Right 1197331436 X:125158026-125158048 CATCAAATTTATGGCGGAGAAGG No data
1197331432_1197331435 -10 Left 1197331432 X:125158007-125158029 CCTAACCTGAAAACAGAGACATC No data
Right 1197331435 X:125158020-125158042 CAGAGACATCAAATTTATGGCGG No data
1197331432_1197331437 8 Left 1197331432 X:125158007-125158029 CCTAACCTGAAAACAGAGACATC No data
Right 1197331437 X:125158038-125158060 GGCGGAGAAGGAATATTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197331432 Original CRISPR GATGTCTCTGTTTTCAGGTT AGG (reversed) Intergenic
No off target data available for this crispr