ID: 1197333772

View in Genome Browser
Species Human (GRCh38)
Location X:125186420-125186442
Sequence CTCAATATGTGACTTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197333772_1197333775 -1 Left 1197333772 X:125186420-125186442 CCTGCCACAAGTCACATATTGAG No data
Right 1197333775 X:125186442-125186464 GATTTGATCCTTAGTGCTGGAGG No data
1197333772_1197333778 4 Left 1197333772 X:125186420-125186442 CCTGCCACAAGTCACATATTGAG No data
Right 1197333778 X:125186447-125186469 GATCCTTAGTGCTGGAGGTGGGG No data
1197333772_1197333776 2 Left 1197333772 X:125186420-125186442 CCTGCCACAAGTCACATATTGAG No data
Right 1197333776 X:125186445-125186467 TTGATCCTTAGTGCTGGAGGTGG No data
1197333772_1197333783 30 Left 1197333772 X:125186420-125186442 CCTGCCACAAGTCACATATTGAG No data
Right 1197333783 X:125186473-125186495 GGTACGAGGTGTTTAGATCATGG No data
1197333772_1197333780 9 Left 1197333772 X:125186420-125186442 CCTGCCACAAGTCACATATTGAG No data
Right 1197333780 X:125186452-125186474 TTAGTGCTGGAGGTGGGGCCTGG No data
1197333772_1197333781 16 Left 1197333772 X:125186420-125186442 CCTGCCACAAGTCACATATTGAG No data
Right 1197333781 X:125186459-125186481 TGGAGGTGGGGCCTGGTACGAGG No data
1197333772_1197333774 -4 Left 1197333772 X:125186420-125186442 CCTGCCACAAGTCACATATTGAG No data
Right 1197333774 X:125186439-125186461 TGAGATTTGATCCTTAGTGCTGG No data
1197333772_1197333777 3 Left 1197333772 X:125186420-125186442 CCTGCCACAAGTCACATATTGAG No data
Right 1197333777 X:125186446-125186468 TGATCCTTAGTGCTGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197333772 Original CRISPR CTCAATATGTGACTTGTGGC AGG (reversed) Intergenic
No off target data available for this crispr