ID: 1197333981

View in Genome Browser
Species Human (GRCh38)
Location X:125188976-125188998
Sequence CAATTTCTACAGACTTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197333981_1197333984 8 Left 1197333981 X:125188976-125188998 CCAGAGCAAGTCTGTAGAAATTG No data
Right 1197333984 X:125189007-125189029 TACATCAGGCTGATTCTGCAAGG No data
1197333981_1197333985 11 Left 1197333981 X:125188976-125188998 CCAGAGCAAGTCTGTAGAAATTG No data
Right 1197333985 X:125189010-125189032 ATCAGGCTGATTCTGCAAGGAGG No data
1197333981_1197333983 -6 Left 1197333981 X:125188976-125188998 CCAGAGCAAGTCTGTAGAAATTG No data
Right 1197333983 X:125188993-125189015 AAATTGGCTTCATATACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197333981 Original CRISPR CAATTTCTACAGACTTGCTC TGG (reversed) Intergenic
No off target data available for this crispr