ID: 1197334679

View in Genome Browser
Species Human (GRCh38)
Location X:125198715-125198737
Sequence TGGGAGTCACTAATTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197334679_1197334686 22 Left 1197334679 X:125198715-125198737 CCATTCTGAATTAGTGACTCCCA No data
Right 1197334686 X:125198760-125198782 CATGGCAGTAGCACAATCAGTGG No data
1197334679_1197334682 4 Left 1197334679 X:125198715-125198737 CCATTCTGAATTAGTGACTCCCA No data
Right 1197334682 X:125198742-125198764 TCTGTCCCATCTAGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197334679 Original CRISPR TGGGAGTCACTAATTCAGAA TGG (reversed) Intergenic
No off target data available for this crispr