ID: 1197335223

View in Genome Browser
Species Human (GRCh38)
Location X:125203894-125203916
Sequence GGCCGAGACGCCCTAAGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197335223 Original CRISPR GGCCGAGACGCCCTAAGTCC CGG (reversed) Intergenic
901597842 1:10399258-10399280 GCCCGAGACGCCGTAGGGCCAGG - Intronic
903287507 1:22286023-22286045 GCCCGAGAGGCCCTGAGGCCTGG - Intergenic
907178831 1:52552796-52552818 GGCTGAGACGCTCTCAGGCCAGG + Intronic
920848794 1:209614725-209614747 GGCCCAGACTCCCTAAATCTGGG + Intergenic
922322989 1:224503915-224503937 GACAGAGACGCCCTCAGGCCTGG + Intronic
922496520 1:226062276-226062298 GCCCGAGACGCCCGCAGGCCGGG + Intronic
924439416 1:244074003-244074025 GGCCCAGATCCCCTAGGTCCTGG - Intergenic
1067721552 10:48731492-48731514 GGCCCAGGAGCCCTGAGTCCCGG - Exonic
1067824757 10:49562764-49562786 GGCCGAGACTGCCTCAGCCCAGG + Intergenic
1067972765 10:50991554-50991576 GGCCGAGATGCCCTGCGCCCGGG - Intronic
1073139676 10:101238889-101238911 GGCAGCGGCGCCCTCAGTCCAGG - Intergenic
1075489001 10:122850086-122850108 GGCCAAGACTCCCTCTGTCCTGG - Intronic
1076136353 10:128047626-128047648 GGCTGAGCCGCGCTAAGGCCTGG - Intronic
1080802058 11:35618520-35618542 GGCCGAAGCGCCCGAAGCCCCGG + Exonic
1081937389 11:46914633-46914655 GGCCCAGATGCCCCATGTCCAGG + Intronic
1093196523 12:16135903-16135925 GGCTGAGAAGTCCTAAGTCAAGG - Intergenic
1096677377 12:53232872-53232894 GACCCAGGCGCCCTAACTCCTGG - Intronic
1105013947 12:132774542-132774564 AGCAGAGACAACCTAAGTCCTGG + Intronic
1112678148 13:101728792-101728814 GGCAGAGACACCCGAAGCCCAGG - Intronic
1114620520 14:24093870-24093892 GGACGCGACACCCTGAGTCCTGG - Intronic
1122126206 14:99579935-99579957 GGCCAAGACTCCCAAAGTCTTGG - Intronic
1127262344 15:57335501-57335523 GGCCCTGACTCCCTAAGTGCAGG - Intergenic
1144756441 17:17682697-17682719 GGCCGCGACGGCCTAGGGCCTGG - Intronic
1149997314 17:61411951-61411973 GGCCGGGACCCCCTATTTCCCGG + Exonic
1152182956 17:78836068-78836090 GGCAGAGAGGCCCTCACTCCGGG - Intronic
1154021668 18:10668830-10668852 AGCCGAGGGGCCCAAAGTCCTGG - Intronic
1156395009 18:36691415-36691437 GCCAGAAATGCCCTAAGTCCAGG - Intronic
1159171637 18:64776847-64776869 GGCTCAGCCTCCCTAAGTCCTGG - Intergenic
1163625295 19:18386103-18386125 GGCGGAGACGGACAAAGTCCGGG + Intronic
925639637 2:5975051-5975073 GTCCGAGAAGCAATAAGTCCAGG + Intergenic
926195246 2:10759727-10759749 GGCTGAGACACCCAAAGTGCTGG - Intronic
1173605166 20:44326697-44326719 GGCCGCGGGGCCCTAACTCCCGG + Intergenic
1174476488 20:50799609-50799631 GGCCCAGGCCCCCTAAGGCCGGG - Intronic
1178860540 21:36285538-36285560 GGCCCAGCCCCCCTGAGTCCTGG + Intronic
1180096601 21:45558246-45558268 GGCTGAGACCCCCCAAGTCCAGG + Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1185311746 22:50159903-50159925 GGCGGAGACTCCCTAGGTCCAGG + Intronic
952931196 3:38362098-38362120 GGCCCAGACTCCCTGTGTCCAGG - Intronic
953690083 3:45110526-45110548 GACCAAGATGCCCAAAGTCCAGG - Exonic
954374103 3:50185261-50185283 GGCCATGACCCCCTATGTCCTGG + Intronic
956162622 3:66371275-66371297 AGCTGAGACGCCCGAAGTCCAGG - Intronic
964354709 3:155839697-155839719 TGCCTAGACTCCCGAAGTCCTGG - Intronic
969096938 4:4740264-4740286 GGCTGAGAAGTCCAAAGTCCAGG - Intergenic
982274783 4:153627922-153627944 GGCACAGATGCCCTATGTCCTGG + Intronic
986184046 5:5420023-5420045 GCCAGAGAAGCCCTAAGACCCGG - Intergenic
1001354643 5:171007630-171007652 GTCTGAGATGCCCTACGTCCAGG - Intronic
1002924010 6:1594600-1594622 GGCCGAGACACCCTGGGTGCTGG - Intergenic
1003514409 6:6806070-6806092 GGCCAAGAAGCCCCCAGTCCAGG - Intergenic
1007626134 6:43247320-43247342 GGCCGAGCAGCCCGAAGCCCCGG - Intronic
1049610463 8:143552765-143552787 GGCTCAGACGCCCAAAGCCCTGG + Intergenic
1056126047 9:83537604-83537626 TCCGGAGACGCCCTCAGTCCCGG - Intronic
1059808307 9:117828536-117828558 GTCCTAGTCACCCTAAGTCCTGG - Intergenic
1062291971 9:135799576-135799598 GGACGTGACGCCCAAAGTCCTGG + Intergenic
1203771974 EBV:54100-54122 GGCCGAGGCGGCCGAGGTCCGGG - Intergenic
1194802710 X:98291941-98291963 GGCCAAGACGGCCGAACTCCAGG - Intergenic
1197335223 X:125203894-125203916 GGCCGAGACGCCCTAAGTCCCGG - Intergenic