ID: 1197335568

View in Genome Browser
Species Human (GRCh38)
Location X:125205792-125205814
Sequence AGCACCGCGTGTGCTCCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197335553_1197335568 30 Left 1197335553 X:125205739-125205761 CCGCGGTGCCACCCCAGCCGTAG No data
Right 1197335568 X:125205792-125205814 AGCACCGCGTGTGCTCCCAAGGG No data
1197335559_1197335568 19 Left 1197335559 X:125205750-125205772 CCCCAGCCGTAGGCAGGTAGGGG No data
Right 1197335568 X:125205792-125205814 AGCACCGCGTGTGCTCCCAAGGG No data
1197335556_1197335568 22 Left 1197335556 X:125205747-125205769 CCACCCCAGCCGTAGGCAGGTAG No data
Right 1197335568 X:125205792-125205814 AGCACCGCGTGTGCTCCCAAGGG No data
1197335561_1197335568 18 Left 1197335561 X:125205751-125205773 CCCAGCCGTAGGCAGGTAGGGGG No data
Right 1197335568 X:125205792-125205814 AGCACCGCGTGTGCTCCCAAGGG No data
1197335563_1197335568 17 Left 1197335563 X:125205752-125205774 CCAGCCGTAGGCAGGTAGGGGGC No data
Right 1197335568 X:125205792-125205814 AGCACCGCGTGTGCTCCCAAGGG No data
1197335564_1197335568 13 Left 1197335564 X:125205756-125205778 CCGTAGGCAGGTAGGGGGCGCGC No data
Right 1197335568 X:125205792-125205814 AGCACCGCGTGTGCTCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197335568 Original CRISPR AGCACCGCGTGTGCTCCCAA GGG Intergenic