ID: 1197337641

View in Genome Browser
Species Human (GRCh38)
Location X:125227158-125227180
Sequence TGTGGTCCAGTTTAATTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197337641_1197337644 26 Left 1197337641 X:125227158-125227180 CCAGTCAATTAAACTGGACCACA No data
Right 1197337644 X:125227207-125227229 TTATGAGTGTATTCTGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197337641 Original CRISPR TGTGGTCCAGTTTAATTGAC TGG (reversed) Intergenic
No off target data available for this crispr