ID: 1197337644

View in Genome Browser
Species Human (GRCh38)
Location X:125227207-125227229
Sequence TTATGAGTGTATTCTGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197337643_1197337644 -1 Left 1197337643 X:125227185-125227207 CCAATGCAAACTCTAGTTAATTT No data
Right 1197337644 X:125227207-125227229 TTATGAGTGTATTCTGTATTTGG No data
1197337642_1197337644 8 Left 1197337642 X:125227176-125227198 CCACACTATCCAATGCAAACTCT No data
Right 1197337644 X:125227207-125227229 TTATGAGTGTATTCTGTATTTGG No data
1197337641_1197337644 26 Left 1197337641 X:125227158-125227180 CCAGTCAATTAAACTGGACCACA No data
Right 1197337644 X:125227207-125227229 TTATGAGTGTATTCTGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197337644 Original CRISPR TTATGAGTGTATTCTGTATT TGG Intergenic
No off target data available for this crispr