ID: 1197346945

View in Genome Browser
Species Human (GRCh38)
Location X:125335705-125335727
Sequence CCCACATCTATCCTGTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197346945_1197346948 -5 Left 1197346945 X:125335705-125335727 CCTTGGAACAGGATAGATGTGGG No data
Right 1197346948 X:125335723-125335745 GTGGGTAGACTGTTGGAGACAGG No data
1197346945_1197346949 0 Left 1197346945 X:125335705-125335727 CCTTGGAACAGGATAGATGTGGG No data
Right 1197346949 X:125335728-125335750 TAGACTGTTGGAGACAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197346945 Original CRISPR CCCACATCTATCCTGTTCCA AGG (reversed) Intergenic
No off target data available for this crispr