ID: 1197346949

View in Genome Browser
Species Human (GRCh38)
Location X:125335728-125335750
Sequence TAGACTGTTGGAGACAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197346943_1197346949 1 Left 1197346943 X:125335704-125335726 CCCTTGGAACAGGATAGATGTGG No data
Right 1197346949 X:125335728-125335750 TAGACTGTTGGAGACAGGAATGG No data
1197346945_1197346949 0 Left 1197346945 X:125335705-125335727 CCTTGGAACAGGATAGATGTGGG No data
Right 1197346949 X:125335728-125335750 TAGACTGTTGGAGACAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197346949 Original CRISPR TAGACTGTTGGAGACAGGAA TGG Intergenic
No off target data available for this crispr