ID: 1197351536

View in Genome Browser
Species Human (GRCh38)
Location X:125388745-125388767
Sequence GGCAAAGCAGGTTATGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197351526_1197351536 16 Left 1197351526 X:125388706-125388728 CCATCTTGAGGTTACTGAAAGAA No data
Right 1197351536 X:125388745-125388767 GGCAAAGCAGGTTATGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197351536 Original CRISPR GGCAAAGCAGGTTATGGGAA TGG Intergenic