ID: 1197352252

View in Genome Browser
Species Human (GRCh38)
Location X:125393523-125393545
Sequence GCAAGTCCTGCTTTTCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197352252_1197352264 8 Left 1197352252 X:125393523-125393545 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1197352264 X:125393554-125393576 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574
1197352252_1197352259 -2 Left 1197352252 X:125393523-125393545 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1197352259 X:125393544-125393566 GCTGCTAAGGGTGAAGGAGAAGG 0: 79
1: 242
2: 300
3: 160
4: 390
1197352252_1197352262 6 Left 1197352252 X:125393523-125393545 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1197352262 X:125393552-125393574 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396
1197352252_1197352261 0 Left 1197352252 X:125393523-125393545 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1197352261 X:125393546-125393568 TGCTAAGGGTGAAGGAGAAGGGG 0: 83
1: 247
2: 292
3: 140
4: 509
1197352252_1197352260 -1 Left 1197352252 X:125393523-125393545 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1197352260 X:125393545-125393567 CTGCTAAGGGTGAAGGAGAAGGG 0: 79
1: 253
2: 407
3: 473
4: 586
1197352252_1197352258 -8 Left 1197352252 X:125393523-125393545 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1197352258 X:125393538-125393560 GGACTTGCTGCTAAGGGTGAAGG 0: 140
1: 558
2: 479
3: 208
4: 227
1197352252_1197352263 7 Left 1197352252 X:125393523-125393545 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1197352263 X:125393553-125393575 GGTGAAGGAGAAGGGGTTGAGGG 0: 375
1: 236
2: 100
3: 101
4: 1002

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197352252 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG (reversed) Intergenic
No off target data available for this crispr