ID: 1197356157

View in Genome Browser
Species Human (GRCh38)
Location X:125439143-125439165
Sequence CTGTCCTAACAGCAGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197356157_1197356159 -4 Left 1197356157 X:125439143-125439165 CCATTTTCCTGCTGTTAGGACAG No data
Right 1197356159 X:125439162-125439184 ACAGTATAGAGCCTAAAATTTGG No data
1197356157_1197356161 30 Left 1197356157 X:125439143-125439165 CCATTTTCCTGCTGTTAGGACAG No data
Right 1197356161 X:125439196-125439218 ATTTTACTCCTAATTGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197356157 Original CRISPR CTGTCCTAACAGCAGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr