ID: 1197358335

View in Genome Browser
Species Human (GRCh38)
Location X:125465824-125465846
Sequence GAAAACAGCCATCACCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197358335_1197358339 2 Left 1197358335 X:125465824-125465846 CCTCAATGGTGATGGCTGTTTTC No data
Right 1197358339 X:125465849-125465871 ACTAGGGCATTGGTTGCTGAAGG No data
1197358335_1197358342 8 Left 1197358335 X:125465824-125465846 CCTCAATGGTGATGGCTGTTTTC No data
Right 1197358342 X:125465855-125465877 GCATTGGTTGCTGAAGGCTGGGG No data
1197358335_1197358340 6 Left 1197358335 X:125465824-125465846 CCTCAATGGTGATGGCTGTTTTC No data
Right 1197358340 X:125465853-125465875 GGGCATTGGTTGCTGAAGGCTGG No data
1197358335_1197358341 7 Left 1197358335 X:125465824-125465846 CCTCAATGGTGATGGCTGTTTTC No data
Right 1197358341 X:125465854-125465876 GGCATTGGTTGCTGAAGGCTGGG No data
1197358335_1197358344 17 Left 1197358335 X:125465824-125465846 CCTCAATGGTGATGGCTGTTTTC No data
Right 1197358344 X:125465864-125465886 GCTGAAGGCTGGGGTGGCTGTGG 0: 53
1: 239
2: 487
3: 596
4: 1320
1197358335_1197358338 -8 Left 1197358335 X:125465824-125465846 CCTCAATGGTGATGGCTGTTTTC No data
Right 1197358338 X:125465839-125465861 CTGTTTTCTGACTAGGGCATTGG No data
1197358335_1197358343 11 Left 1197358335 X:125465824-125465846 CCTCAATGGTGATGGCTGTTTTC No data
Right 1197358343 X:125465858-125465880 TTGGTTGCTGAAGGCTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197358335 Original CRISPR GAAAACAGCCATCACCATTG AGG (reversed) Intergenic
No off target data available for this crispr