ID: 1197358339

View in Genome Browser
Species Human (GRCh38)
Location X:125465849-125465871
Sequence ACTAGGGCATTGGTTGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197358335_1197358339 2 Left 1197358335 X:125465824-125465846 CCTCAATGGTGATGGCTGTTTTC No data
Right 1197358339 X:125465849-125465871 ACTAGGGCATTGGTTGCTGAAGG No data
1197358332_1197358339 26 Left 1197358332 X:125465800-125465822 CCTTTTTGCTGGTGGAGGCTTTT No data
Right 1197358339 X:125465849-125465871 ACTAGGGCATTGGTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197358339 Original CRISPR ACTAGGGCATTGGTTGCTGA AGG Intergenic
No off target data available for this crispr