ID: 1197370518

View in Genome Browser
Species Human (GRCh38)
Location X:125621110-125621132
Sequence TTCAACCCCTCCAGCATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197370518_1197370523 16 Left 1197370518 X:125621110-125621132 CCTACCATGCTGGAGGGGTTGAA No data
Right 1197370523 X:125621149-125621171 GGTCACAACATTCCAATAGGTGG No data
1197370518_1197370522 13 Left 1197370518 X:125621110-125621132 CCTACCATGCTGGAGGGGTTGAA No data
Right 1197370522 X:125621146-125621168 GCTGGTCACAACATTCCAATAGG No data
1197370518_1197370520 -5 Left 1197370518 X:125621110-125621132 CCTACCATGCTGGAGGGGTTGAA No data
Right 1197370520 X:125621128-125621150 TTGAATTGTTCCTGTACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197370518 Original CRISPR TTCAACCCCTCCAGCATGGT AGG (reversed) Intergenic
No off target data available for this crispr