ID: 1197370519

View in Genome Browser
Species Human (GRCh38)
Location X:125621114-125621136
Sequence ACAATTCAACCCCTCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197370519_1197370523 12 Left 1197370519 X:125621114-125621136 CCATGCTGGAGGGGTTGAATTGT No data
Right 1197370523 X:125621149-125621171 GGTCACAACATTCCAATAGGTGG No data
1197370519_1197370522 9 Left 1197370519 X:125621114-125621136 CCATGCTGGAGGGGTTGAATTGT No data
Right 1197370522 X:125621146-125621168 GCTGGTCACAACATTCCAATAGG No data
1197370519_1197370520 -9 Left 1197370519 X:125621114-125621136 CCATGCTGGAGGGGTTGAATTGT No data
Right 1197370520 X:125621128-125621150 TTGAATTGTTCCTGTACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197370519 Original CRISPR ACAATTCAACCCCTCCAGCA TGG (reversed) Intergenic
No off target data available for this crispr