ID: 1197370523

View in Genome Browser
Species Human (GRCh38)
Location X:125621149-125621171
Sequence GGTCACAACATTCCAATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197370518_1197370523 16 Left 1197370518 X:125621110-125621132 CCTACCATGCTGGAGGGGTTGAA No data
Right 1197370523 X:125621149-125621171 GGTCACAACATTCCAATAGGTGG No data
1197370519_1197370523 12 Left 1197370519 X:125621114-125621136 CCATGCTGGAGGGGTTGAATTGT No data
Right 1197370523 X:125621149-125621171 GGTCACAACATTCCAATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197370523 Original CRISPR GGTCACAACATTCCAATAGG TGG Intergenic
No off target data available for this crispr