ID: 1197370712

View in Genome Browser
Species Human (GRCh38)
Location X:125622213-125622235
Sequence TACTGCTGGTAGGTTTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197370704_1197370712 13 Left 1197370704 X:125622177-125622199 CCTGCCAGCTTGAGTATCCATGG No data
Right 1197370712 X:125622213-125622235 TACTGCTGGTAGGTTTCCATAGG No data
1197370709_1197370712 -4 Left 1197370709 X:125622194-125622216 CCATGGGTGTTGTGGAGTCTACT No data
Right 1197370712 X:125622213-125622235 TACTGCTGGTAGGTTTCCATAGG No data
1197370707_1197370712 9 Left 1197370707 X:125622181-125622203 CCAGCTTGAGTATCCATGGGTGT No data
Right 1197370712 X:125622213-125622235 TACTGCTGGTAGGTTTCCATAGG No data
1197370703_1197370712 14 Left 1197370703 X:125622176-125622198 CCCTGCCAGCTTGAGTATCCATG No data
Right 1197370712 X:125622213-125622235 TACTGCTGGTAGGTTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197370712 Original CRISPR TACTGCTGGTAGGTTTCCAT AGG Intergenic
No off target data available for this crispr