ID: 1197371414

View in Genome Browser
Species Human (GRCh38)
Location X:125630131-125630153
Sequence ACTAGGACTCCATTTTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197371414_1197371417 7 Left 1197371414 X:125630131-125630153 CCAGATAAAAATGGAGTCCTAGT No data
Right 1197371417 X:125630161-125630183 TCTTGCAACAGAATAAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197371414 Original CRISPR ACTAGGACTCCATTTTTATC TGG (reversed) Intergenic
No off target data available for this crispr