ID: 1197372060

View in Genome Browser
Species Human (GRCh38)
Location X:125637898-125637920
Sequence AGTTACCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197372055_1197372060 15 Left 1197372055 X:125637860-125637882 CCAGTAACAGGCCAAGAGCTGCC 0: 9
1: 173
2: 187
3: 147
4: 210
Right 1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG No data
1197372057_1197372060 4 Left 1197372057 X:125637871-125637893 CCAAGAGCTGCCTCTCAGAAGGA No data
Right 1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG No data
1197372054_1197372060 16 Left 1197372054 X:125637859-125637881 CCCAGTAACAGGCCAAGAGCTGC No data
Right 1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG No data
1197372058_1197372060 -6 Left 1197372058 X:125637881-125637903 CCTCTCAGAAGGAGAGTAGTTAC No data
Right 1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197372060 Original CRISPR AGTTACCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr