ID: 1197374027

View in Genome Browser
Species Human (GRCh38)
Location X:125660200-125660222
Sequence GGTACTGAGTTTATAGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197374021_1197374027 15 Left 1197374021 X:125660162-125660184 CCTCTTTCTGCTTATAGCTTCTG No data
Right 1197374027 X:125660200-125660222 GGTACTGAGTTTATAGATCTAGG No data
1197374020_1197374027 18 Left 1197374020 X:125660159-125660181 CCACCTCTTTCTGCTTATAGCTT No data
Right 1197374027 X:125660200-125660222 GGTACTGAGTTTATAGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197374027 Original CRISPR GGTACTGAGTTTATAGATCT AGG Intergenic
No off target data available for this crispr