ID: 1197375882

View in Genome Browser
Species Human (GRCh38)
Location X:125681738-125681760
Sequence AGTGAGAGTGCAATGACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197375874_1197375882 25 Left 1197375874 X:125681690-125681712 CCCAGCAGCAGCCTTGCAGCACA No data
Right 1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG No data
1197375873_1197375882 26 Left 1197375873 X:125681689-125681711 CCCCAGCAGCAGCCTTGCAGCAC No data
Right 1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG No data
1197375875_1197375882 24 Left 1197375875 X:125681691-125681713 CCAGCAGCAGCCTTGCAGCACAA No data
Right 1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG No data
1197375876_1197375882 14 Left 1197375876 X:125681701-125681723 CCTTGCAGCACAAAGAGAGCATC No data
Right 1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197375882 Original CRISPR AGTGAGAGTGCAATGACTGG AGG Intergenic
No off target data available for this crispr