ID: 1197376062

View in Genome Browser
Species Human (GRCh38)
Location X:125682942-125682964
Sequence CTCTGGACACACTTGGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197376057_1197376062 -3 Left 1197376057 X:125682922-125682944 CCTTTTCTCACAGACAGCGTCTC No data
Right 1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197376062 Original CRISPR CTCTGGACACACTTGGGGCT TGG Intergenic
No off target data available for this crispr