ID: 1197378100 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:125707056-125707078 |
Sequence | AGTATCAAATTCATCAATTA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1197378100_1197378102 | -6 | Left | 1197378100 | X:125707056-125707078 | CCTTAATTGATGAATTTGATACT | No data | ||
Right | 1197378102 | X:125707073-125707095 | GATACTTGGTCTTTCCTACTTGG | No data | ||||
1197378100_1197378105 | 26 | Left | 1197378100 | X:125707056-125707078 | CCTTAATTGATGAATTTGATACT | No data | ||
Right | 1197378105 | X:125707105-125707127 | CACCCTGTCATGCATTTAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1197378100 | Original CRISPR | AGTATCAAATTCATCAATTA AGG (reversed) | Intergenic | ||