ID: 1197378102

View in Genome Browser
Species Human (GRCh38)
Location X:125707073-125707095
Sequence GATACTTGGTCTTTCCTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197378100_1197378102 -6 Left 1197378100 X:125707056-125707078 CCTTAATTGATGAATTTGATACT No data
Right 1197378102 X:125707073-125707095 GATACTTGGTCTTTCCTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197378102 Original CRISPR GATACTTGGTCTTTCCTACT TGG Intergenic