ID: 1197378103

View in Genome Browser
Species Human (GRCh38)
Location X:125707087-125707109
Sequence GGGTGGACAAAAATCCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197378103_1197378108 2 Left 1197378103 X:125707087-125707109 CCTACTTGGATTTTTGTCCACCC No data
Right 1197378108 X:125707112-125707134 TCATGCATTTAAGTGGTGAGAGG No data
1197378103_1197378109 18 Left 1197378103 X:125707087-125707109 CCTACTTGGATTTTTGTCCACCC No data
Right 1197378109 X:125707128-125707150 TGAGAGGTTATTGTTGTCATTGG No data
1197378103_1197378105 -5 Left 1197378103 X:125707087-125707109 CCTACTTGGATTTTTGTCCACCC No data
Right 1197378105 X:125707105-125707127 CACCCTGTCATGCATTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197378103 Original CRISPR GGGTGGACAAAAATCCAAGT AGG (reversed) Intergenic