ID: 1197378104

View in Genome Browser
Species Human (GRCh38)
Location X:125707104-125707126
Sequence CACTTAAATGCATGACAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197378104_1197378110 14 Left 1197378104 X:125707104-125707126 CCACCCTGTCATGCATTTAAGTG No data
Right 1197378110 X:125707141-125707163 TTGTCATTGGTATGATTATAAGG No data
1197378104_1197378109 1 Left 1197378104 X:125707104-125707126 CCACCCTGTCATGCATTTAAGTG No data
Right 1197378109 X:125707128-125707150 TGAGAGGTTATTGTTGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197378104 Original CRISPR CACTTAAATGCATGACAGGG TGG (reversed) Intergenic