ID: 1197378104 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:125707104-125707126 |
| Sequence | CACTTAAATGCATGACAGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197378104_1197378110 | 14 | Left | 1197378104 | X:125707104-125707126 | CCACCCTGTCATGCATTTAAGTG | No data | ||
| Right | 1197378110 | X:125707141-125707163 | TTGTCATTGGTATGATTATAAGG | No data | ||||
| 1197378104_1197378109 | 1 | Left | 1197378104 | X:125707104-125707126 | CCACCCTGTCATGCATTTAAGTG | No data | ||
| Right | 1197378109 | X:125707128-125707150 | TGAGAGGTTATTGTTGTCATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197378104 | Original CRISPR | CACTTAAATGCATGACAGGG TGG (reversed) | Intergenic | ||