ID: 1197378105

View in Genome Browser
Species Human (GRCh38)
Location X:125707105-125707127
Sequence CACCCTGTCATGCATTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197378103_1197378105 -5 Left 1197378103 X:125707087-125707109 CCTACTTGGATTTTTGTCCACCC No data
Right 1197378105 X:125707105-125707127 CACCCTGTCATGCATTTAAGTGG No data
1197378100_1197378105 26 Left 1197378100 X:125707056-125707078 CCTTAATTGATGAATTTGATACT No data
Right 1197378105 X:125707105-125707127 CACCCTGTCATGCATTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197378105 Original CRISPR CACCCTGTCATGCATTTAAG TGG Intergenic