ID: 1197378106

View in Genome Browser
Species Human (GRCh38)
Location X:125707107-125707129
Sequence CACCACTTAAATGCATGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197378106_1197378109 -2 Left 1197378106 X:125707107-125707129 CCCTGTCATGCATTTAAGTGGTG No data
Right 1197378109 X:125707128-125707150 TGAGAGGTTATTGTTGTCATTGG No data
1197378106_1197378110 11 Left 1197378106 X:125707107-125707129 CCCTGTCATGCATTTAAGTGGTG No data
Right 1197378110 X:125707141-125707163 TTGTCATTGGTATGATTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197378106 Original CRISPR CACCACTTAAATGCATGACA GGG (reversed) Intergenic