ID: 1197378107

View in Genome Browser
Species Human (GRCh38)
Location X:125707108-125707130
Sequence TCACCACTTAAATGCATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197378107_1197378110 10 Left 1197378107 X:125707108-125707130 CCTGTCATGCATTTAAGTGGTGA No data
Right 1197378110 X:125707141-125707163 TTGTCATTGGTATGATTATAAGG No data
1197378107_1197378109 -3 Left 1197378107 X:125707108-125707130 CCTGTCATGCATTTAAGTGGTGA No data
Right 1197378109 X:125707128-125707150 TGAGAGGTTATTGTTGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197378107 Original CRISPR TCACCACTTAAATGCATGAC AGG (reversed) Intergenic