ID: 1197378109

View in Genome Browser
Species Human (GRCh38)
Location X:125707128-125707150
Sequence TGAGAGGTTATTGTTGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197378104_1197378109 1 Left 1197378104 X:125707104-125707126 CCACCCTGTCATGCATTTAAGTG No data
Right 1197378109 X:125707128-125707150 TGAGAGGTTATTGTTGTCATTGG No data
1197378106_1197378109 -2 Left 1197378106 X:125707107-125707129 CCCTGTCATGCATTTAAGTGGTG No data
Right 1197378109 X:125707128-125707150 TGAGAGGTTATTGTTGTCATTGG No data
1197378103_1197378109 18 Left 1197378103 X:125707087-125707109 CCTACTTGGATTTTTGTCCACCC No data
Right 1197378109 X:125707128-125707150 TGAGAGGTTATTGTTGTCATTGG No data
1197378107_1197378109 -3 Left 1197378107 X:125707108-125707130 CCTGTCATGCATTTAAGTGGTGA No data
Right 1197378109 X:125707128-125707150 TGAGAGGTTATTGTTGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197378109 Original CRISPR TGAGAGGTTATTGTTGTCAT TGG Intergenic