ID: 1197379997

View in Genome Browser
Species Human (GRCh38)
Location X:125727889-125727911
Sequence AGCCTGTTACTGGGCTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197379997_1197380004 26 Left 1197379997 X:125727889-125727911 CCACCTAAGCCCAGTAACAGGCT No data
Right 1197380004 X:125727938-125727960 GTTTTCTGCAGAAGATGGCAGGG No data
1197379997_1197380003 25 Left 1197379997 X:125727889-125727911 CCACCTAAGCCCAGTAACAGGCT No data
Right 1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG No data
1197379997_1197380002 21 Left 1197379997 X:125727889-125727911 CCACCTAAGCCCAGTAACAGGCT No data
Right 1197380002 X:125727933-125727955 GAGTAGTTTTCTGCAGAAGATGG No data
1197379997_1197380001 -1 Left 1197379997 X:125727889-125727911 CCACCTAAGCCCAGTAACAGGCT No data
Right 1197380001 X:125727911-125727933 TAAGAGCTGTCTCTCAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197379997 Original CRISPR AGCCTGTTACTGGGCTTAGG TGG (reversed) Intergenic
No off target data available for this crispr