ID: 1197379999

View in Genome Browser
Species Human (GRCh38)
Location X:125727898-125727920
Sequence ACAGCTCTTAGCCTGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197379999_1197380001 -10 Left 1197379999 X:125727898-125727920 CCCAGTAACAGGCTAAGAGCTGT No data
Right 1197380001 X:125727911-125727933 TAAGAGCTGTCTCTCAAAAGAGG No data
1197379999_1197380003 16 Left 1197379999 X:125727898-125727920 CCCAGTAACAGGCTAAGAGCTGT No data
Right 1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG No data
1197379999_1197380002 12 Left 1197379999 X:125727898-125727920 CCCAGTAACAGGCTAAGAGCTGT No data
Right 1197380002 X:125727933-125727955 GAGTAGTTTTCTGCAGAAGATGG No data
1197379999_1197380004 17 Left 1197379999 X:125727898-125727920 CCCAGTAACAGGCTAAGAGCTGT No data
Right 1197380004 X:125727938-125727960 GTTTTCTGCAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197379999 Original CRISPR ACAGCTCTTAGCCTGTTACT GGG (reversed) Intergenic
No off target data available for this crispr