ID: 1197380000

View in Genome Browser
Species Human (GRCh38)
Location X:125727899-125727921
Sequence GACAGCTCTTAGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197380000_1197380004 16 Left 1197380000 X:125727899-125727921 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1197380004 X:125727938-125727960 GTTTTCTGCAGAAGATGGCAGGG No data
1197380000_1197380002 11 Left 1197380000 X:125727899-125727921 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1197380002 X:125727933-125727955 GAGTAGTTTTCTGCAGAAGATGG No data
1197380000_1197380003 15 Left 1197380000 X:125727899-125727921 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197380000 Original CRISPR GACAGCTCTTAGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr