ID: 1197380003

View in Genome Browser
Species Human (GRCh38)
Location X:125727937-125727959
Sequence AGTTTTCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197379998_1197380003 22 Left 1197379998 X:125727892-125727914 CCTAAGCCCAGTAACAGGCTAAG 0: 9
1: 177
2: 167
3: 118
4: 218
Right 1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG No data
1197380000_1197380003 15 Left 1197380000 X:125727899-125727921 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG No data
1197379999_1197380003 16 Left 1197379999 X:125727898-125727920 CCCAGTAACAGGCTAAGAGCTGT No data
Right 1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG No data
1197379997_1197380003 25 Left 1197379997 X:125727889-125727911 CCACCTAAGCCCAGTAACAGGCT No data
Right 1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197380003 Original CRISPR AGTTTTCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr