ID: 1197383083

View in Genome Browser
Species Human (GRCh38)
Location X:125769561-125769583
Sequence GAGACCTGGGCAATTTGCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197383083_1197383087 -8 Left 1197383083 X:125769561-125769583 CCGTAGCAAATTGCCCAGGTCTC No data
Right 1197383087 X:125769576-125769598 CAGGTCTCCCCTTCAGGAAGAGG No data
1197383083_1197383090 0 Left 1197383083 X:125769561-125769583 CCGTAGCAAATTGCCCAGGTCTC No data
Right 1197383090 X:125769584-125769606 CCCTTCAGGAAGAGGCAGTTTGG No data
1197383083_1197383093 15 Left 1197383083 X:125769561-125769583 CCGTAGCAAATTGCCCAGGTCTC No data
Right 1197383093 X:125769599-125769621 CAGTTTGGACTCTGGCTGTATGG No data
1197383083_1197383092 7 Left 1197383083 X:125769561-125769583 CCGTAGCAAATTGCCCAGGTCTC No data
Right 1197383092 X:125769591-125769613 GGAAGAGGCAGTTTGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197383083 Original CRISPR GAGACCTGGGCAATTTGCTA CGG (reversed) Intergenic
No off target data available for this crispr