ID: 1197383090

View in Genome Browser
Species Human (GRCh38)
Location X:125769584-125769606
Sequence CCCTTCAGGAAGAGGCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197383083_1197383090 0 Left 1197383083 X:125769561-125769583 CCGTAGCAAATTGCCCAGGTCTC No data
Right 1197383090 X:125769584-125769606 CCCTTCAGGAAGAGGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197383090 Original CRISPR CCCTTCAGGAAGAGGCAGTT TGG Intergenic
No off target data available for this crispr