ID: 1197383092

View in Genome Browser
Species Human (GRCh38)
Location X:125769591-125769613
Sequence GGAAGAGGCAGTTTGGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197383083_1197383092 7 Left 1197383083 X:125769561-125769583 CCGTAGCAAATTGCCCAGGTCTC No data
Right 1197383092 X:125769591-125769613 GGAAGAGGCAGTTTGGACTCTGG No data
1197383086_1197383092 -7 Left 1197383086 X:125769575-125769597 CCAGGTCTCCCCTTCAGGAAGAG No data
Right 1197383092 X:125769591-125769613 GGAAGAGGCAGTTTGGACTCTGG No data
1197383085_1197383092 -6 Left 1197383085 X:125769574-125769596 CCCAGGTCTCCCCTTCAGGAAGA No data
Right 1197383092 X:125769591-125769613 GGAAGAGGCAGTTTGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197383092 Original CRISPR GGAAGAGGCAGTTTGGACTC TGG Intergenic
No off target data available for this crispr