ID: 1197383093

View in Genome Browser
Species Human (GRCh38)
Location X:125769599-125769621
Sequence CAGTTTGGACTCTGGCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197383088_1197383093 -7 Left 1197383088 X:125769583-125769605 CCCCTTCAGGAAGAGGCAGTTTG No data
Right 1197383093 X:125769599-125769621 CAGTTTGGACTCTGGCTGTATGG No data
1197383091_1197383093 -9 Left 1197383091 X:125769585-125769607 CCTTCAGGAAGAGGCAGTTTGGA No data
Right 1197383093 X:125769599-125769621 CAGTTTGGACTCTGGCTGTATGG No data
1197383085_1197383093 2 Left 1197383085 X:125769574-125769596 CCCAGGTCTCCCCTTCAGGAAGA No data
Right 1197383093 X:125769599-125769621 CAGTTTGGACTCTGGCTGTATGG No data
1197383089_1197383093 -8 Left 1197383089 X:125769584-125769606 CCCTTCAGGAAGAGGCAGTTTGG No data
Right 1197383093 X:125769599-125769621 CAGTTTGGACTCTGGCTGTATGG No data
1197383083_1197383093 15 Left 1197383083 X:125769561-125769583 CCGTAGCAAATTGCCCAGGTCTC No data
Right 1197383093 X:125769599-125769621 CAGTTTGGACTCTGGCTGTATGG No data
1197383086_1197383093 1 Left 1197383086 X:125769575-125769597 CCAGGTCTCCCCTTCAGGAAGAG No data
Right 1197383093 X:125769599-125769621 CAGTTTGGACTCTGGCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197383093 Original CRISPR CAGTTTGGACTCTGGCTGTA TGG Intergenic
No off target data available for this crispr