ID: 1197386113

View in Genome Browser
Species Human (GRCh38)
Location X:125804448-125804470
Sequence TGTTAGTTCACTTAGGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9163
Summary {0: 6, 1: 121, 2: 614, 3: 1629, 4: 6793}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197386113_1197386118 21 Left 1197386113 X:125804448-125804470 CCATAATCCTAAGTGAACTAACA 0: 6
1: 121
2: 614
3: 1629
4: 6793
Right 1197386118 X:125804492-125804514 CACATGTTGTTACTTATAGGTGG No data
1197386113_1197386116 18 Left 1197386113 X:125804448-125804470 CCATAATCCTAAGTGAACTAACA 0: 6
1: 121
2: 614
3: 1629
4: 6793
Right 1197386116 X:125804489-125804511 TACCACATGTTGTTACTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197386113 Original CRISPR TGTTAGTTCACTTAGGATTA TGG (reversed) Intergenic
Too many off-targets to display for this crispr