ID: 1197386114

View in Genome Browser
Species Human (GRCh38)
Location X:125804455-125804477
Sequence TTTCTTCTGTTAGTTCACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197386114_1197386118 14 Left 1197386114 X:125804455-125804477 CCTAAGTGAACTAACAGAAGAAA No data
Right 1197386118 X:125804492-125804514 CACATGTTGTTACTTATAGGTGG No data
1197386114_1197386116 11 Left 1197386114 X:125804455-125804477 CCTAAGTGAACTAACAGAAGAAA No data
Right 1197386116 X:125804489-125804511 TACCACATGTTGTTACTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197386114 Original CRISPR TTTCTTCTGTTAGTTCACTT AGG (reversed) Intergenic
No off target data available for this crispr