ID: 1197386116

View in Genome Browser
Species Human (GRCh38)
Location X:125804489-125804511
Sequence TACCACATGTTGTTACTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197386114_1197386116 11 Left 1197386114 X:125804455-125804477 CCTAAGTGAACTAACAGAAGAAA No data
Right 1197386116 X:125804489-125804511 TACCACATGTTGTTACTTATAGG No data
1197386113_1197386116 18 Left 1197386113 X:125804448-125804470 CCATAATCCTAAGTGAACTAACA 0: 6
1: 121
2: 614
3: 1629
4: 6793
Right 1197386116 X:125804489-125804511 TACCACATGTTGTTACTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197386116 Original CRISPR TACCACATGTTGTTACTTAT AGG Intergenic
No off target data available for this crispr