ID: 1197386776

View in Genome Browser
Species Human (GRCh38)
Location X:125812275-125812297
Sequence AGATATCTGCAGTAGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197386770_1197386776 25 Left 1197386770 X:125812227-125812249 CCATCAAAGCCTAGTAACAGGCC No data
Right 1197386776 X:125812275-125812297 AGATATCTGCAGTAGATTGCAGG No data
1197386771_1197386776 16 Left 1197386771 X:125812236-125812258 CCTAGTAACAGGCCAAGAGCCGG No data
Right 1197386776 X:125812275-125812297 AGATATCTGCAGTAGATTGCAGG No data
1197386774_1197386776 4 Left 1197386774 X:125812248-125812270 CCAAGAGCCGGTTCTCAAAAGGA No data
Right 1197386776 X:125812275-125812297 AGATATCTGCAGTAGATTGCAGG No data
1197386775_1197386776 -3 Left 1197386775 X:125812255-125812277 CCGGTTCTCAAAAGGAGAGTAGA No data
Right 1197386776 X:125812275-125812297 AGATATCTGCAGTAGATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197386776 Original CRISPR AGATATCTGCAGTAGATTGC AGG Intergenic
No off target data available for this crispr