ID: 1197392299 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:125882912-125882934 |
| Sequence | GAACCATTCAACAAGTCTCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5863 | |||
| Summary | {0: 9, 1: 433, 2: 2088, 3: 2045, 4: 1288} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197392299_1197392304 | 27 | Left | 1197392299 | X:125882912-125882934 | CCTAGAGACTTGTTGAATGGTTC | 0: 9 1: 433 2: 2088 3: 2045 4: 1288 |
||
| Right | 1197392304 | X:125882962-125882984 | CAATGAAGTACAGTCTGAGGTGG | No data | ||||
| 1197392299_1197392303 | 24 | Left | 1197392299 | X:125882912-125882934 | CCTAGAGACTTGTTGAATGGTTC | 0: 9 1: 433 2: 2088 3: 2045 4: 1288 |
||
| Right | 1197392303 | X:125882959-125882981 | GGGCAATGAAGTACAGTCTGAGG | No data | ||||
| 1197392299_1197392302 | 4 | Left | 1197392299 | X:125882912-125882934 | CCTAGAGACTTGTTGAATGGTTC | 0: 9 1: 433 2: 2088 3: 2045 4: 1288 |
||
| Right | 1197392302 | X:125882939-125882961 | CAAAATGCAGACAGTAATATGGG | No data | ||||
| 1197392299_1197392301 | 3 | Left | 1197392299 | X:125882912-125882934 | CCTAGAGACTTGTTGAATGGTTC | 0: 9 1: 433 2: 2088 3: 2045 4: 1288 |
||
| Right | 1197392301 | X:125882938-125882960 | CCAAAATGCAGACAGTAATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197392299 | Original CRISPR | GAACCATTCAACAAGTCTCT AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||