ID: 1197392299

View in Genome Browser
Species Human (GRCh38)
Location X:125882912-125882934
Sequence GAACCATTCAACAAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5863
Summary {0: 9, 1: 433, 2: 2088, 3: 2045, 4: 1288}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197392299_1197392304 27 Left 1197392299 X:125882912-125882934 CCTAGAGACTTGTTGAATGGTTC 0: 9
1: 433
2: 2088
3: 2045
4: 1288
Right 1197392304 X:125882962-125882984 CAATGAAGTACAGTCTGAGGTGG No data
1197392299_1197392303 24 Left 1197392299 X:125882912-125882934 CCTAGAGACTTGTTGAATGGTTC 0: 9
1: 433
2: 2088
3: 2045
4: 1288
Right 1197392303 X:125882959-125882981 GGGCAATGAAGTACAGTCTGAGG No data
1197392299_1197392302 4 Left 1197392299 X:125882912-125882934 CCTAGAGACTTGTTGAATGGTTC 0: 9
1: 433
2: 2088
3: 2045
4: 1288
Right 1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG No data
1197392299_1197392301 3 Left 1197392299 X:125882912-125882934 CCTAGAGACTTGTTGAATGGTTC 0: 9
1: 433
2: 2088
3: 2045
4: 1288
Right 1197392301 X:125882938-125882960 CCAAAATGCAGACAGTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197392299 Original CRISPR GAACCATTCAACAAGTCTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr